| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Centre for Cellular and Molecular Biology, Hyderabad, India.
| Correspondence to: Dr K. Thangaraj, Centre for Cellular and Molecular Biology, Uppal Rd, Hyderabad 500 007, India (e-mail: thangs{at}ccmb.res.in). |
| Received for publication February 7, 2007; accepted for publication May 21, 2007. |
 |
Abstract |
|---|
 Top Abstract Subjects, Materials, and MethodsResultsDiscussionReferences |
|---|
Key words: XY sex primary amenorrhea reversal, primary amenorrhea, androgens, complete androgen insensitivity syndrome, Leydig cell hyperplasia, ligand binding
The AR gene mapped to Xq11.2-q12 encodes a protein with 919 amino acids. The AR protein has a domain organization consisting of N-terminal domain, DNA-binding domain, and a C-terminal ligand-binding domain (LBD). In addition to ligand binding, LBD is also involved in nuclear localization, receptor dimerization, and interaction with other proteins (Brinkmann et al, 1989). Mutations in the AR gene are known to cause complete androgen insensitivity syndrome (CAIS) represented by female phenotype, partial androgen insensitivity syndrome (PAIS), with phenotype ranging from predominantly male to female, and mild androgen insensitivity syndrome (MAIS) characterized by undermasculinization (Tsukada et al, 1994) or infertility in otherwise healthy males (Rajender et al, 2007).
Hundreds of mutations have been reported in the AR gene worldwide (Gottlieb et al, 2004). Most of these studies are accompanied by functional assays to show the mechanism of the pathogenesis of the mutation. Various mutations in the AR gene have resulted either in the loss of androgen binding to the receptor molecule or loss in the transactivation potential of the ligand-AR complex without significant loss in the ligand binding. In our earlier report, we identified a C3693T (mRNA position) missense mutation in the AR gene in a familial case of CAIS. On the basis of the information from the nature of the mutation and its location in the ligand-binding pocket of the receptor molecule, we proposed that the mutation might have resulted in the loss of the ligand binding (Singh et al, 2006). We have now conducted in vitro functional assays to prove the mechanism of action of the mutation.
|
Subjects, Materials, and Methods |
|---|
|
TopAbstractSubjects, Materials, and MethodsResultsDiscussionReferences |
|---|
Construction of the Mutant AR Clone
The AR clone (pSVARo) and the reporter clone (pMMTV-Luc) were the
kind gifts from Dr Bruce Gottlieb. We designed the complimentary primers
having the mutation in the middle of forward and reverse primers. The 2 primer
sequences were as follows: forward: 5'
GACGCTTCTACCAGTTCACCAAGCTCCTG 3' (the mutated base is
underlined); reverse: 5' CAGGAGCTTGGTGAACTGGTAGAAGCGTC
3' (the mutated base is underlined). The whole plasmid molecule bearing
the AR clone was amplified using QuikChange site-directed mutagenesis
kit (Stratagene, La Jolla, Calif) with the primers bearing the desired
mutation. The 50-µL polymerase chain reaction (PCR) consisted of PCR buffer
5.0 µL, each primer 50 pmol, plasmid DNA 50 ng, deoxy nucleotide tri
phosphates (dNTPs) 1.0 µL, and PfuTurbo DNA polymerase 1.0 µL.
The reaction was set up under the following PCR conditions: 95°C for 30
seconds followed by 16 cycles of denaturation at 95°Cfor 30 seconds,
annealing at 55°C for 1 minute, and polymerization at 68°C for 10
minutes with a final extension at 68°C for 10 minutes. The amplicon from
the above reaction was incubated at 37°C for 1 hour with DpnI
restriction enzyme to digest the wild-type (parental) plasmid molecules. Upon
digestion, the amplified product was checked on 1% agarose gel for
quantitative and qualitative analyses.
Bacterial Transformation and Plasmid Isolation (Miniprep)
The amplified product was used for the transformation in Escherichia
coli; 25 ng of the plasmid DNA was transformed into E coli by
heat shock at 42°C for 45 seconds. The ampicillin-resistant colonies were
picked up and used for plasmid isolation. The plasmid DNA was isolated with
the Mini prep kit (Bangalore Genei, India) following the protocol provided by
the manufacturers. The DNA was dissolved in an appropriate quantity of
tris-EDTA (TE) buffer. After incubating at room temperature for 2 hours, the
plasmid DNA was checked on 2% agarose gel for qualitative and quantitative
evaluation.
Direct DNA Sequencing and Plasmid Isolation (Maxiprep)
The plasmid DNA (approximately 400 ng) was directly sequenced to confirm
the presence of the mutation in the clone using Big-Dye chain terminator cycle
sequencing protocol on 3730 DNA analyzer (Applied Biosystems, Foster City,
Calif) (Thangaraj et al,
2003). The plasmid was isolated on a large scale using the
maxiprep kit (Qiagen Inc, Valencia, Calif) from the mutant colonies following
the protocol provided by the manufacturers. The plasmid DNA was evaluated on
2% agarose gel for quantitative and qualitative analyses.
Androgen-Binding Assay
About 800 ng of the plasmid DNA was used for transfection of COS1 cells
using 4.8 µL of lipofectamine (Stratagene, La Jolla, Calif). After 72 hours
of the transfection, the cells were washed with PBS and medium replaced with a
medium containing 5% charcoal-stripped steroid-free serum. After 96 hours, the
cells were harvested using 0.01% trypsin–0.02% EDTA in
phosphate-buffered saline (PBS). The harvested cells were divided into 2
fractions for Western blotting and ligand-binging assays. The cells were
counted by using a hemocytometer to adjust the cell density. Equal volumes of
cell suspension with same cell density were incubated with 0.5–2.0 nmol
of methyltrienolone (R1881) in the presence and absence of 1000-fold unlabeled
methyltrienolone to determine specific and nonspecific ligand binding,
respectively. After the incubation, the cells were washed with 2 mL of PBS 3
times to remove any unbound ligand. The cells were lysed with cell lysis
solution (50 mM Tris-Cl [pH 8.0], 10 mM EDTA [pH 8.0], 100 mM NaCl, 0.5%
[vol/vol] Triton X-100, and 0.01 mL of protease inhibitor mixture per mL
[Sigma-Aldrich Corporation, St Louis, Mo]). The whole cell lysate was then
mixed with 6 mL of scintillation counting fluid Bio-Safe II (Research Products
International Corp, Mount Prospect, Ill), and the disintegrations per second
were counted with the liquid scintillation analyzer (1500 TRI-CARB; Packard,
Downers Grove, Ill). The results were expressed as binding sites per
105 cells.
Western Blotting
The harvested cells were lysed in the Laemmli buffer (50 mM Tris with pH
6.8, 2% sodium dodecyl sulfate [SDS], 10% glycerol, 5% ß-mercaptoethanol,
0.01% bromophenol blue) and boiled for 10 minutes in a water bath according to
the method of Laemmli (1970).
The cell lysate was centrifuged at 10 000 rpm for 3 minutes (Biofuge pico,
Heraeus Instruments, Hanau, Germany) and supernatant collected. Protein
content of each lysate was estimated in the supernatant by Amido Black method
(Kaplan and Pedersen, 1985).
Equal amounts of the protein for different samples were loaded on
SDS—polyacrylamide gel electrophoresis (SDS-PAGE) (10%) and
electrophoresed at 80 V in running buffer (25 mM Tris, 250 mM glycine, 1% SDS
with pH 8.3). The resolved proteins were electrophoretically transferred to a
nitrocellulose membrane (Hybond C, Amersham Life Sciences, Little Chalfont,
United Kingdom) following the semidry method of Towbin et al
(1979). Subsequently the
membrane was stained with 0.1% Ponceau S (prepared in 1% acetic acid) to check
the efficiency of the transfer. Before hybridization with the antibodies, the
membrane was washed with distilled water to remove the Ponceau stain and
blocked with 5% (wt/vol) nonfat milk in TBST (150 mM NaCl, 20 mM Tris-HCl,
0.1% Tween 20, pH 7.6) for 2 hours at room temperature. Subsequently, the
membrane was washed and incubated with 1:10 000 dilution of primary antibody
in TBST. After 2 hours of incubation with the primary antibody, the membrane
was washed with TBST (3 times, 5 minutes each) and incubated with 1:1000
dilution of alkaline phosphatase–conjugated secondary antibody in TBST.
After 1 hour of incubation, the membrane was washed with TBST (3 times, 5
minutes each). Upon hybridization, the blot was incubated in alkaline
phosphatase buffer (100 mM NaCl, 5 mM MgCl2, 100 mM Tris, pH 9.5) to which
nitro-blue tetrazolium chloride (NBT) (66 µL for 10 mL of buffer) and
5-bromo-4-chloro-3'-indolylphosphate p-toluidine (BCIP) salt (33 µL
for 10 mL buffer) were added. The blot was incubated in the dark until a
distinct band appeared.
|
|
|
Results |
|---|
|
TopAbstractSubjects, Materials, and MethodsResultsDiscussionReferences |
|---|
|
|
Discussion |
|---|
|
TopAbstractSubjects, Materials, and MethodsResultsDiscussionReferences |
|---|
The in vitro assays revealed that the androgen binding was reduced to negligible levels as a result of the mutation. This could be due to the fact that the mutated amino acid localized to LBD. However, the observation of no transactivation in the mutant receptor must be due to the loss of complex formation between androgen and AR protein. The AR protein normally forms complex with the androgen and localizes to the nucleus. However, the absence of ligand or failure of ligand binding to the receptor results in the cytoplasmic localization of the receptor with perinuclear distribution, enforcing its faster degradation (Kemppainen et al, 1992). Therefore, the mutations resulting in complete loss of androgen binding should result in failure of nuclear localization of the AR protein, resulting in rapid degradation. Similarly, the complete loss of androgen binding as a result of L859F mutation in the present case would have rendered the AR protein nonfunctional along with its rapid degradation as a result of cytoplasmic localization.
Most of the reported mutations associated with androgen insensitivity syndrome localize to LBD and are available at the androgen receptor mutation database along with resulting phenotypes (Gottlieb et al, 2004). The mechanism of pathogenesis of most of these mutations is well supported by the functional assays. The mutations resulting in the replacement of the amino acids by similar other amino acids should result in partial loss of function, whereas the replacement of an amino acid by a dissimilar amino acid should result in complete loss of function. However, this did not hold true when we compared the nature of amino acid substitution with the extent of androgen insensitivity for the mutations reported in exon 7 to date (available at the AR mutation database) (Gottlieb et al, 2004). Exon 7 is the second highly mutated region of the AR gene after exon 5. More than 37 different types of mutations have been reported in 127 individuals (Gottlieb et al, 2004). Of these mutations, the most (20 mutations) were reported in CAIS cases, followed by PAIS (11 mutations), CAIS and PAIS (4 mutations), MAIS (1 mutation), and prostate cancer (1 mutation). Many mutations replacing a highly dissimilar amino acid resulted in PAIS and did not alter the ligand binding, whereas many other mutations replacing a similar amino acid without significantly altering ligand binding resulted in CAIS. Likewise, the mutation under study resulted in the replacement of a hydrophobic amino acid with another hydrophobic amino acid but resulted in CAIS. However, unlike other mutations, we observed complete loss of ligand binding. The above discussion shows that the ultimate phenotype in AR mutations does not depend upon the kind of amino acids replaced but on the extent of the conservation of that particular amino acid and its location in the 3-dimensional crystal structure of the protein.
Mutations in the AR gene are known to show phenotypic variation in different individuals. Substantial variations have been noted in the familial cases bearing the same mutation. Somatic mutations in the androgen target tissues have been proposed to contribute to phenotypic variation. However, somatic mutations have been able to explain the phenomenon only in a few cases of the more than 25 cases of phenotypic variation reported to date (Gottlieb et al, 2001a,b). All the patients in the present family exhibited same phenotype; however, the phenotypic variation associated with this mutation cannot be ruled out in further generations if somatic mutations in the androgen-responsive tissues result in the back mutation. Certain mutations in the AR gene are even known to result in a gradient of the phenotypes in different affected individuals. However, this is the first report of the L859F mutation; therefore, phenotypic variations associated with this mutation have to wait for more studies reporting the same mutation.
The patients were given estrogen therapy and underwent surgery to construct the female genital organs. We are in communication with the patients to provide genetic counseling for future pregnancies of their healthy siblings to abandon the transmission of the mutated X chromosome to the coming generations.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractSubjects, Materials, and MethodsResultsDiscussionReferences |
|---|
Gottlieb B, Beitel LK, Trifiro MA. A somatic mosaicism and variable expressivity. Trends Genet. 2001a; 17: 79 -82.[CrossRef][Medline]
Gottlieb B, Beitel LK, Trifiro MA. Variable expressivity and mutation databases: the androgen receptor gene mutations database. Hum Mutat. 2001b; 17: 382 -388.[CrossRef][Medline]
Gottlieb B, Beitel LK, Wu JH, Trifiro M. The androgen receptor gene mutations database (ARDB): 2004 update. Hum Mutat. 2004; 23: 527 -533.[CrossRef][Medline]
Haqq CM, Donahoe PK. Regulation of sexual dimorphism in mammals.
Physiol Rev. 1998; 78: 1
-33.
Kaplan RS, Pedersen PL. Determination of microgram quantities of protein in the presence of milligram levels of lipid with amido black 10B. Anal Biochem. 1985; 150: 97 -104.[CrossRef][Medline]
Kemppainen JA, Lane MV, Sar M, Wilson EM. Androgen receptor
phosphorylation, turnover, nuclear transport, and transcriptional activation.
Specificity for steroids and antihormones. J Biol
Chem. 1992;267: 968
-974.
Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970; 227: 680 -685.[CrossRef][Medline]
Rajender S, Singh L, Thangaraj K. Phenotypic heterogeneity of mutations in androgen receptor gene. Asian J Androl. 2007; 9: 147 -179.[CrossRef][Medline]
Singh R, Shastry PK, Rasalkar AA, Singh L, Thangaraj K. A novel
androgen receptor mutation resulting in complete androgen insensitivity
syndrome and bilateral Leydig cell hyperplasia. J
Androl. 2006;27: 510
-516.
Thangaraj K, Singh L, Reddy AG, Rao VR, Sehgal SC, Underhill PA, Pierson M, Frame IG, Hagelberg E. Genetic affinities of the Andaman Islanders, a vanishing human population. Curr Biol. 2003; 13: 86 -93.[CrossRef][Medline]
Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of
proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some
applications. Proc Natl Acad Sci U S A. 1979; 76: 4350
-4354.
Tsukada T, Inoue M, Tachibana S, Nakai Y, Takebe H. An androgen receptor mutation causing androgen resistance in undervirilized male syndrome. J Clin Endocrinol Metab. 1994; 79: 1202 -1207.[Abstract]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
