| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the Department of Urology, Saitama Medical Center, Saitama Medical School, Kawagoe, Saitama, Japan.
| Correspondence to: Dr Tetsuo Hayashi, Department of Urology, Saitama Medical Center, Saitama Medical School, 1981 Tsujido, Kamoda, Kawagoe, Saitama 350-8550, Japan (e-mail: hayashi{at}saitama-med.ac.jp). |
| Received for publication January 7, 2004; accepted for publication April 21, 2004. |
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
Np63 mRNA was
already recognized in the vas deferens at day 0 after birth and advanced
chronologically along the duct to the caput epididymis and p63 protein was
expressed in basal cells in their epithelium, whereas the mRNAs of Jagged 2
and Notch 1 were maintained at a low level. Consequently, examination of our
data raises the probability that TAp63 has an important role for maintenance
of germ cell numbers, triggering or balancing the development,
differentiation, and apoptosis of germ cells in the testis, which is
completely different from the role of Np63 in other epithelial
tissues.
Key words: Spermatogenesis, p53, differentiation
Above all, the testis has the specific function of generating spermatozoa from precursors termed spermatogonia after a complex series of divisions (Clermont and Huckins, 1961; de Kretser and Kerr, 1994). This process takes place within the seminiferous epithelium, which is a complex structure composed of a stratified arrangement of germ cells with their cellular associations in progressive steps of differentiation and radially oriented supporting cells called Sertoli cells. Moreover, apoptosis of germ cells in the testis plays an important role in providing an intratubular environment for progression of spermatogenesis by controlling the number of each cell type (Hayashi et al, 2000, 2002).
On the other hand, the vaso-epididymal system is a single duct, which is differentiated from the Wolffian duct and conveys spermatozoa from the testis (Robaire and Hermo, 1988; Hermo et al, 1994; Kirchhoff, 1999; Atanassova et al, 2001). Spermatozoa undergo numerous changes along the epididymal duct that result in the acquisition of fertilizing ability (Hinton et al, 1995; Turner and Miller, 1997). All of these changes are controlled by the epididymal epithelium and take place progressively as the spermatozoa pass through the epididymis, which is divided into 3 major regions: caput, corpus, and cauda (Cooper, 1998; Holland and Nixon, 1998; Turner et al, 1999). This region-specific functional difference in a single Wolffian duct is accompanied by morphological differences in the luminal epithelium. Therefore, the testis and each region of vaso-epididymal system have their own specific structures and functions, although all these tubules and ducts are contiguous and collaborate with each other in the development of male gamete along their lengths.
A member of the tumor suppressor p53 family of genes,
p63, also termed p51, encodes p63 with strong
structural and functional similarities to p53
(Osada et al, 1998;
Yang et al, 1998). However,
p63 considerably differs from p53 in its requirement for the
developmental morphogenesis in some tissues and recent immunohistochemical
studies detected p63 expression in basal cells of mammalian tissues
(Mills et al, 1999;
Yang et al, 1999; Wang et al 2001). Although the
function of p63 is not fully understood, targeted studies
demonstrated that this gene is highly expressed in the basal or progenitor
layers of many epithelial tissues and plays a key role in maintaining their
cell populations (Mills et al,
1999; Yang et al,
1999; Wang et al
2001). Moreover, the p63 gene encodes for 2 major classes
of protein. The TAp63 isoforms can transactivate p53 target genes and
induce apoptosis when overproduced, whereas Np63 isoforms potentially
suppress transactivation by both p53 and TAp63 isoforms in a
dominant-negative manner (Osada et al,
1998; Yang et al,
1998). On the other hand, Notch 1 and its ligand Jagged 2,
critical factors in cell type specification, have an important role in the
differentiation of germ cells (Hayashi et
al, 2001) and Jagged 2 is up-regulated by TAp63
, one of
p63 isoforms, which can trigger the Notch signaling system
(Sasaki et al, 2002). Although
expression patterns of p63 in most epithelia are established, the role of
p63 and its possible relationship with the Notch signaling system in
the seminiferous epithelium has not been examined yet.
In the following study, we examined the expression of p63 isoforms and Notch 1 and Jagged 2 transcripts in the developing rat testis and also examined those in the epididymis and vas deferens, the representative epithelium of the male reproductive tract, as an initial step to elucidate the physiological role of p63 and the Notch signaling system and the possible relationship between them in the regulation of the proliferation and differentiation of germ cells in comparison with the epithelial cells in the male reproductive tract. Examination of the data provides new insights into the role of these proteins in the biology of the testis.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Each tissue was cut in half. Then half of each tissue at the same age was snap frozen and pooled upon collection for RNA extractions with Isogen (WAKO Pure Chemical Industry, Tokyo, Japan), an RNA isolation reagent. The remaining half of each tissue was fixed in Bouin's fluid for 5–8 hours immediately upon collection, dehydrated, and embedded in paraffin for immunohistochemistry.
Northern Blot Analysis
The cDNA was synthesized from 2 µg of the total RNA samples by using the
SuperScript Preamplification System for First-Strand cDNA Synthesis (Life
Technologies, Gaithersburg, Md). Two microliters of the synthesized cDNA
samples were subjected to polymerase chain reaction (PCR) with 2 µL of
10x reaction buffer (100 mM Tris-HCl pH 8.3 containing 500 mM KCl), 2
µL of deoxynucleoside triphosphate mixture (1.25 mM each of deoxyadenosine
triphosphate, deoxycytosine triphosphate, deoxythymidine triphosphate, and
deoxyguanosine triphosphate), 2 µL of an upper-strand primer (10 µM), 2
µL of a lower-strand primer (10 µM), 0.1 µL of AmpliTaq DNA
polymerases (5 U/µL, TAKARA Biomedicals, Tokyo, Japan), and 12 µL of
H2O. The reaction was performed by denaturing for 30 seconds at
94°C, annealing for 30 seconds at 60°C, and extending for 60 seconds
at 72°C. Twenty-four cycles of PCR were performed for Notch 1 and 30
cycles were used for Jagged 2, Np63, and TAp63. The sequences of the
primers and expected fragment sizes are as follows: Notch 1,
CTGTGAGCCCACATCCGAGA and AGTTGCACTGGCTGTCACAG (330 bp); Jagged 2,
ATCAACGCCGAGCCTGACCA and GCCAATCAGGTTTTTGCAAG (360 bp); Np63,
GGAAAACAATGCCCAGACTC and GAAGGACACGTCGAAACTGTG (252 bp); and TAp63,
GGTGCGACAAACAAGATTGAG and GAAGGACACGTCGAAACTGTG (296 bp). The amplified
products were electrophoresed in 1.5% agarose gels stained with ethidium
bromide. The PCR products were sequenced to verify their identity as described
previously (Hayashi et al,
2001). The PCR for Np63, TAp63, Jagged 2, and Notch 1 was
performed with a cDNA sample of appropriate pools. The amplified products of
expected size were cut out from agarose gels, purified by using a Geneclean II
kit (BIO 101 Inc, La Jolla, Calif), and then cloned into a pGEM-T Easy plasmid
vector (Promega Corporation, Madison, Wis) with T4 DNA ligase. The DNA
sequences of inserts were determined in both directions by using T7 (TAK-ARA
Biomedicals) and SP6 promoter primer (Stratagene, La Jolla, Calif). Each set
of primers used for reverse transcription–PCR also was used for the
sequencing reaction. We employed dideoxy chain reaction methods by using a
Thermo Sequenase dye terminator cycle sequencing premix kit (Amersham Life
Science, Inc, Cleveland, Ohio). For Northern blot analysis, total RNA (10
µg) was electrophoretically separated on a 1% agarose gel containing 2.2 M
formaldehyde and blotted on a nitrocellulose membrane. The RNA was visualized
with ethidium bromide to ensure that it was intact and loaded in similar
amounts and to confirm proper transfer. Hybridization was performed with alpha
32P-labeled DNA probes prepared from PCR clones as described
previously (Hayashi et al,
2001). Quantitative analysis of mRNA transcript was defined as the
ratio to adult control level after normalization against the abundance of 28S
RNA. Experiments were repeated 4 times for each mRNA to establish the
reproducibility of these results and data are shown as the mean of 4
experiments.
Immunohistochemistry for the Detection of p63 Protein
Immunohistochemistry was employed to localize the p63 in rat
sections by following standard protocols with minor modifications as
previously described (Hayashi et al,
2001). Briefly, 5-µm sections were floated on diethyl
pyrocarbonate–treated MilliQ (Millipore, Bedford, Mass) water and dried
onto slides. Then sections were dewaxed, rehydrated, treated with 0.3%
hydrogen peroxide for 5 minutes, and heated to 100°C in 50 mM glycine, pH
3.5, for 10 minutes. Slides were washed twice in Tris-buffered saline (TBS; 10
mM Tris, 150 mM NaCl, pH 7.6) for 5 minutes between all subsequent
incubations, which were performed at room temperature in a humid chamber. A
blocking solution was added for 20 minutes, consisting of 5% normal serum
diluted in TBS with 0.1% bovine serum albumin (TB). Primary antibodies were
diluted in TB and incubated for 60 min. A mouse monoclonal antibody 4A4
(sc-8431; Santa Cruz Biotechnology, Inc, Santa Cruz, Calif) raised
specifically against all p63 isoforms was used at a dilution of
1:200. Incubation with biotinylated secondary rabbit anti-mouse immunoglobulin
G diluted in TB proceeded for 30 minutes, followed by incubation with
streptavidin–horseradish peroxidase (Silenus, Tokyo, Japan) at 2.68
µg/ml for 30 minutes. Antibody binding was visualized by using hydrogen
peroxide–activated diaminobenzidine tetrahydrochloride (2.13 mg/ml in
TBS; Sigma). Sections were cleared in xylene and mounted with Permount (Fisher
Scientific Corp, Fairlawn, NJ). As negative controls, sections were processed
together in an identical manner, except for substitution of either mouse
anti-p63 primary antibody with an equivalent dilution of nonimmune serum. In
all cases, no significant staining was observed for control serum in any
tissues. Experiments were repeated 5 times to establish reproducibility.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Np63, TAp63, Jagged 2, and Notch 1 mRNAs in the Testis, Epididymis, and Vas DeferensNp63 mRNA was at a low level
(Figure 1). In the adult
epididymis and vas deferens, on the other hand, Np63 mRNA was highly
expressed, whereas the expressions of TAp63, Jagged 2, and Notch 1 mRNAs were
at a low level (Figure 1).
|
During postnatal development, TAp63, Jagged 2, and Notch 1 mRNAs were at
low levels in the testis at day 0 after birth. The expression of TAp63 mRNA
began to increase markedly at day 14 after birth and reached the adult level
at day 16 after birth, and then the expression of Jagged 2 and Notch 1 mRNAs
began to increase progressively in the testis (Figures
2 and
3). On the other hand, in the
caput, corpus, and cauda epididymis, the expression of Np63 mRNA was at
low level at day 0 after birth and then increased markedly at days 18, 16, and
14 after birth, respectively, whereas its high expression was already
recognized at day 0 after birth and continued during postnatal development in
the vas deferens. However, Jagged 2 and Notch 1 mRNAs were expressed at a low
level at all the ages examined during postnatal development in the
vaso-epididymal system (Figures
4 and
5).
|
|
|
|
Tissue Localization of p63 Protein in the Testis, Epididymis, and Vas Deferens
The expression of p63 protein was not detectable at day 0 after
birth in the rat testis (Figure
6A), whereas it was detectable at first in spermatocytes in the
rat seminiferous tubules at day 14 after birth
(Figure 6B). Positive staining
was confined to nuclear regions of spermatocytes. The p63-positive
spermatocytes increased in number as the diameter of seminiferous tubules
increased in size (Figure 6C and
D). However, no positive staining was present in spermatogonia,
spermatids, or spermatozoa in the adult testis
(Figure 6D).
|
On the other hand, the expression of p63 protein was detectable from day 0 after birth only in the vas deferens (Figure 7C1 and C2), whereas it was not detectable in cauda epididymis and caput epididymis until day 14 or day 18 after birth, respectively (Figure 7A1 through B2), and positive staining was confined to nuclear regions of basal cells of their epithelium.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
, one of the p63 isoforms,
which can trigger the Notch signaling system
(Sasaki et al, 2002).
Therefore, examination of our results first shows the probability that
p63-mediated Jagged 2 induction activates the Notch signaling system in the
testis, which plays an important role for germ cell differentiation. Moreover,
evidence exists to indicate that TAp63 isoforms can transactivate p53
target genes and induce apoptosis when overproduced
(Osada et al, 1998;
Yang et al, 1998). Therefore,
it is possible that TAp63 has an important role for maintenance of the number
of germ cells of each type by triggering or balancing the development,
differentiation, and apoptosis of germ cells in the testis.
On the other hand, the current study is also the first to demonstrate that
the beginning of the marked increase of Np63 mRNA expression advanced
chronologically along the duct from vas deferens to caput epididymis in the
highly region- and age-specific manner and that the convolution of the tubule
was recognized in the part of mesonephric tubule with a low level of
Np63 expression at birth, suggesting the probability that the
convolution of the tubule occurs while Np63 expression is at a low
level and ceases after the expression increased to the adult level. There is
evidence to indicate that Np63 isoforms play a critical role in
regulating differentiation of the normal epithelium and maintaining normal
epithelium structure (Mills et al,
1999; Yang et al,
1999; Yang and McKeon,
2000). Therefore, it seems most likely that the chronological
differences of Np63 expression play an important role in the regional
differences in the morphology and function of the mesonephric tubule, which
differentiates into various parts of epididymis and vas deferens.
In conclusion, it seems most likely that the role of TAp63 in the testis is
completely different from the role of the Np63 in the epithelial
tissues of the vaso-epididymal system. Examination of the data in this study
now clearly raises the probability that TAp63 governs the balance between
development, differentiation, and apoptosis of germ cells in the testis
through the Notch signaling system and p53 target genes, facilitating
an understanding of the action of these proteins in the testis, and that the
chronological differences of Np63 expression have an important role for
the regional differences in the development of the epithelial cells of
mesonephric tubule, which result in their morphological and functional
differences. Clearly, further studies are required to determine how TAp63
controls the number of germ cells by modulating the balance between
development, differentiation, and apoptosis of germ cells and how Np63
mediates the differentiation of epithelial cells in the mesonephric
tubule.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Clermont Y, Huckins C. Microscopic anatomy of the sex cords and seminiferous tubules in growing and adult male albino rats. Am J Anat. 1961;108: 79 -97.
Cooper TG. Interactions between epididymal secretions and spermatozoa. J Reprod Fertil Suppl. 1998; 53: 119 -136.[Medline]
de Kretser DM, Kerr JB. The cytology of the testis. In: Knobil E, Neill JD, eds. The Physiology of Reproduction, Vol 1 , 2nd ed. New York, NY: Raven Press; 1994 : 1177-1290.
de Kretser DM, Temple-Smith PD, Kerr JB. Anatomical and functional aspects of the male reproductive organs. In: Bandhauer K, Frick J, eds. Handbook of Urology. Vol XVI. Disturbances in Male Fertility. Berlin, Germany: Springer-Verlag; 1982 : 1-131.
Hayashi T, Kageyama Y, Ishizaka K, Kihara K, Oshima H. Sexual
dimorphism in the regulation of meiotic process in the rabbit. Biol
Reprod. 2000;62: 1722
-1727.
Hayashi T, Kageyama Y, Ishizaka K, Kihara K, Oshima H. Involvement of apoptosis in the control of Sertoli and pre-meiotic germ cell numbers in the developing rabbit testis. Andrologia. 2002; 34: 34 -40.[Medline]
Hayashi T, Kageyama Y, Ishizaka K, Xia GB, Kihara K, Oshima H. Requirement of Notch 1 and its ligand Jagged 2 expressions for spermatogenesis in rat and human testes. J Androl. 2001; 22: 999 -1011.[Abstract]
Hermo L, Oko R, Morales CR. Secretion and endocytosis in the male reproductive tract: a role in sperm maturation. Int Rev Cytol. 1994;154: 106 -189.[Medline]
Hinton BT, Palldino MA, Rudolph D, Labus JC. The epididymis as protector of maturing spermatozoa. Reprod Fertil Dev. 1995; 7: 731 -745.[Medline]
Holland MK, Nixon B. The specificity of epididymal secretory proteins. J Reprod Fertil Suppl. 1998; 53: 197 -210.[Medline]
Kirchhoff C. Gene expression in the epididymis. Int Rev Cytol. 1999;188: 133 -202.[Medline]
Mills A, Zheng B, Wang X, Vogel H, Roop D, Bradley A. p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature. 1999;398: 708 -713.[Medline]
Osada M, Ohba M, Kawahara C, et al. Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nat Med. 1998;4: 839 -843.[Medline]
Robaire B, Hermo L. Efferent duct, epididymis and vas deferens; structure, functions and their regulation. In: Knobil E, Neill JD, eds. The Physiology of Reproduction. Vol 1 . New York, NY: Raven Press; 1988: 999 -1080.
Sasaki Y, Ishida S, Morimoto I, et al. The p53 family member genes are involved in the Notch signal pathway. J Biol Chem. 2002; 227: 719 -724.
Turner TT, Miller DW. On the synthesis and secretion of rat seminiferous tubule proteins in vivo after ischemia and germ cell loss. Biol Reprod. 1997; 57: 1275 -1284.[Abstract]
Turner TT, Riley TA, Mruk DD, Cheng CY. Obstruction of the vas
deferens alters protein secretion by the rat caput epididymal epithelium in
vivo. J Androl. 1999; 20: 289
-297.
Wang T, Chen B, Yang Y, et al. Histologic and immunophenotypic classification of cervical carcinomas by expression of the p53 homologue p63: a study of 250 cases. Hum Pathol. 2001; 32: 479 -486.[Medline]
Yang A, Kaghad M, Wang Y, et al. p63, a p53 homolog at 3q27–29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell. 1998; 2: 305 -316.[Medline]
Yang A, McKeon F. p63 and p73: p53 mimics, menaces and more. Nat Rev Mol Cell Biol. 2000; 1: 199 -207.[Medline]
Yang A, Schweitzer R, Sun D, et al. p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature. 1999;398: 714 -718.[Medline]
This article has been cited by other articles:
|
|
 |
|
  I. J. Frew, A. Minola, S. Georgiev, M. Hitz, H. Moch, S. Richard, A. O. Vortmeyer, and W. Krek Combined Vhlh and Pten Mutation Causes Genital Tract Cystadenoma and Squamous Metaplasia Mol. Cell. Biol., July 15, 2008; 28(14): 4536 - 4548. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Corallini, S. Fera, L. Grisanti, I. Falciatori, B. Muciaccia, M. Stefanini, and E. Vicini Expression of the adaptor protein m-Numb in mouse male germ cells. Reproduction, December 1, 2006; 132(6): 887 - 897. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Atanassova, C. McKinnell, J. Fisher, and R. M Sharpe Neonatal treatment of rats with diethylstilboestrol (DES) induces stromal-epithelial abnormalities of the vas deferens and cauda epididymis in adulthood following delayed basal cell development Reproduction, May 1, 2005; 129(5): 589 - 601. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
