| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |




From the * Unitat de Recerca Biomèdica and
Departament d'Anatomia Patològica,
Hospital Materno-Infantil Vall d'Hebron, Barcelona, Spain;
Department of Cell Biology, Georgetown
University Medical Center, Washington, DC; and the
Department of Pharmacology and Cancer Biology,
Duke University Medical Center, Durham, North Carolina.
| Correspondence to: Dr Francina Munell, Unitat de Recerca Biomèdica, Hospital Materno-Infantil Vall d'Hebrón, Ps. Vall d'Hebrón, 119-129, 08035 Barcelona, Spain (e-mail: fmunell{at}vhebron.net). |
| Received for publication April 10, 2003; accepted for publication August 7, 2003. |
| Abstract |
|---|
|
|
|---|
Key words: germ cell apoptosis, testicular toxicity, Laser Capture Microdissection
The relationship between sex steroids and germ cell survival/death in the testis has been the subject of extensive analysis and is known to entail the absolute requirement for androgens (Zirkin et al, 1989; Henriksen et al, 1995; Woolveridge et al, 1999), although the precise action(s) or the somatic cell most vitally responsive to androgens remains a matter of debate (Súarez-Quian et al, 1999). Of interest, a more comprehensive and emerging view of the hormonal control of spermatogenesis raises the possibility that androgens may not be the exclusive steroid responsible for its regulation and that estrogens may also participate in such capacity. First, germ cell apoptosis induced by incubating segments of human seminiferous tubules without survival factors can be inhibited by low concentrations of estradiol (Pentikainen et al, 2000). Second, estradiol treatment of the hypogonadal mouse, which congenitally lacks gonadotrophins and presents a meiotic arrest at the pachytene stage, induces the progression and completion of spermatogenesis in the absence of measurable androgen concentrations (Ebling et al, 2000). Third, estradiol treatment also induces the initiation of spermatogenesis in photo-regressed male Siberian hamsters (Park et al, 2002). Fourth, it has been shown that germ cells express cytochrome P450 aromatase (Nitta et al, 1993; Carreau and Levallet, 1997; Janulis et al, 1998, Levallet et al, 1998; Carreau et al, 2002) and that mice lacking functional aromatase are infertile and exhibit a reduction in round and elongated spermatids and an increase in germ cell apoptosis (Robertson et al, 1999).
A recently identified form of a second estrogen receptor, the estrogen receptor ß (ERß; Kuiper et al, 1996), was found to be expressed in pachytene spermatocytes as well as in other germ and/or somatic cells of the testis (Saunders et al, 1998; Van Pelt et al, 1999; Pentikainen et al, 2000; O'Donnell et al, 2001). Given that the survival of pachytene spermatocytes depends on androgens and no evidence of androgen receptors has been demonstrated in these cells, it is possible that androgens would somehow enter freely into germ cells (or be delivered by androgen-binding protein)once there, they would be aromatized to estrogens. Alternatively, estrogens produced by testicular somatic cells (Carreau et al, 2002) could also enter into germ cells. In this scenario, ERß could mediate the effects of estradiol in the regulation of primary spermatocyte survival and/or apoptosis.
In the present investigation, we chose a well-established model of pachytene spermatocyte apoptosis consisting in a single intraperitoneal injection of methoxyacetic acid (MAA) in adult rats that results in almost complete loss of pachytene spermatocytes (Brinkworth et al, 1995), to examine whether the massive and stage-specific cellular apoptosis entailed the alteration of normal ERß levels. The temporal expression of ERß mRNA and protein was analyzed during the time course of the apoptotic process and compared with the results of morphological and biochemical apoptotic assays. Analysis of the spatial expression of ERß mRNA was achieved using laser capture microdissection (LCM) in combination with reverse transcription-polymerase chain reaction (RT-PCR) of stage-specific seminiferous tubules (Suárez-Quian et al, 2000; Tirado et al, 2003). Furthermore, the activation of ERß by MAA was tested in a cell-based transcription assay system using a luciferase reporter construct that contains a consensus estrogen responsive element cotransfected with ERß in HepG2 cells. The data presented provide evidence for the induction of ERß mRNA and protein prior to pachytene spermatocyte cell death by apoptosis and support the involvement of this receptor in the regulation of the meiotic progression of primary spermatocytes.
| Materials and Methods |
|---|
|
|
|---|
DNA Isolation and DNA Fragmentation Analysis on Agarose Gel![]()
Total DNA was isolated from individual frozen testes by digestion in lysis
buffer (20 mmol/L Tris-HCl [pH 7.4], 1 mmol/L EDTA, and 1% sodium dodecyl
sulfate [SDS]) and proteinase K (10 µg/mL) at 56°C overnight. DNA was
extracted with phenol/chloroform and precipitated by the addition of sodium
acetate and ethanol. The DNA was resuspended in low-TE buffer (20 mmol/L
Tris-HCl [pH 7.4] and 1 mmol/L EDTA [pH 8]), and its concentration was
measured by spectrophotometry. An equal amount of DNA from each sample was
loaded onto 2% agarose gel and blotted to Hybond-N nylon membrane (Amersham)
by overnight capillary transfer using 10x standard saline citrate (SSC;
3 mol/L NaCl and 0.3 mol/L trisodium citrate). Blots were hybridized at
42°C, overnight, using rat total genomic DNA labeled by random priming
with 32P d-CTP as the probe
(Macaya et al, 1994). Finally,
the membranes were washed in decreasing concentrations of SSPE (3.6 mol/L
NaCl, 0.2 mol/L Na2 HPO47H2O, and 0.02 mol/L
EDTA)/0.1% SDS and autoradiographed.
Histological Examination and In Situ End Labeling of Fragmented DNA
(TUNEL)![]()
TUNEL assay was done as described elsewhere
(Selva et al, 2000). In brief,
dewaxed and rehydrated sections were treated with 20 µg/mL proteinase K for
15 minuutes and with 3% hydrogen peroxide for 5 minutes. After an incubation
with terminal deoxynucleotidyltransferase (TdT) buffer (25 nmol/L Tris HCl,
200 mmol/L cacodylate acid, and 200 mmol/L KCl) for 15 minutes, sections were
treated with 0.05 U/µL TdT (Roche Molecular Biochemicals, Mannheim,
Germany) and 0.5 nM biotin-16-deoxy(d)UTP (Roche Molecular Biochemicals) in
TdT buffer at 37°C for 90 minutes and with 300 mmol/L NaCl and 30 mmol/L
SSC at room temperature for 15 minutes. After washing and incubating with 2%
bovine serum albumin, sections were exposed to avidin-biotin complex (Vector
Laboratories Inc., Burlingame, CA), diluted 1: 25, at 37°C for 45 minutes,
and the peroxidase reaction was visualized with diaminobenzidine and hydrogen
peroxide. Counting individually labeled cells in at least 3 sections per
sample served as our quantitation protocol.
Germ Cell Isolation![]()
Germ cells were isolated from the testis as described elsewhere
(Weiss et al, 1997;
Selva et al, 2000). Testes
were excised and washed with phosphate-buffered saline (PBS) supplemented with
penicillin-streptomycin (5 mg/mL) and amphotericin (5 mg/mL), decapsulated,
minced, and incubated in 100 mL of the above PBS solution for 8 minutes. The
medium was removed, and the remaining testicular pieces were digested in
trypsin (80 mg/mL)/PBS at 33°C for 10 min. The reaction was stopped by the
addition of 25 mg/mL trypsin inhibitor, and the resulting solution was treated
with deoxyribonuclease (0.4 mg/mL) at room temperature for 5 minutes. The
isolated tubules were minced in a petri dish for 30 minutes and sequentially
filtered through a 100-µm pore size nylon filter, a fine glass-fiber
filter, and a 20-µm pore size nylon filter. The recovered solution was
centrifuged at 95 x g for 10 min, and the pellet was
resuspended in 15 mL Dulbecco's minimum essential medium (DMEM)/Nutrient
Mixture (NUT) mix F-12 culture medium (Life Technologies Inc., Gaithersburg,
MD) supplemented with 10% fetal bovine serum (FBS). The cell suspension was
incubated in the same medium in tissue culture flasks for 5 hours, and the
supernatant, free of Sertoli cells, was recovered and centrifuged at 95
x g for 10 minutes. The pellet was frozen until its use for RNA
extraction. This protocol ensures the purity of the germ cell fraction, as it
has been shown using vimentin as a marker for Sertoli cell contamination
(Selva et al, 2002).
Messenger RNA Isolation and Analysis of Its Expression by
Semiquantitative RT-PCR![]()
Total and messenger RNA were extracted from unseparated testicular cells
and from isolated germ cells by means of guanidium
thiocyanate/phenol-chloroform extraction
(Chomzinsky and Sacchi, 1987)
and by use of the Quickprep mRNA purification Kit (Pharmacia Biotech). One
microgram of total RNA or, alternatively, 0.25 µg of eluted mRNA was
reverse transcribed using 200 U of Superscript II Rnase H-Reverse Trancriptase
(Gibco-BRL, Bethesda, MD), according to supplier's instructions. For rat
ERß, a 735-bp product was amplified (upper primer: TGCTGGATGGAGGTGCTAATG,
lower primer: ACACAACCACCCTGACTCCT) and for the rat ribosomal protein L19, a
486-bp fragment was obtained (upper primer: CAATGCCAACTCTCGTCAAC, lower
primer: CTTGGTCTCTTCCTCCTTGG). Amplification consisted of 40 cycles for
ERß and 32 cycles for the control gene L19, both within the linear growth
phase of the PCR reaction. Annealing was done at 57°C for 30 seconds. PCR
products were separated on a 2% agarose gel and quantified by the Molecular
Analyst/Macintosh data analysis software using a Bio-Rad Image Analysis System
(Bio-Rad Laboratories Inc., Hercules, CA). The products of amplification were
purified using the QIA-quick PCR Purification Kit (Quiagen, Hilden, Germany),
according to supplier's instructions, and sequenced using an Abi Prism 310
genetic analyzer (Perkin-Elmer Corp.).
ERß Immunohistochemistry![]()
For ERß immunodetection, tissue sections were deparaffinized and
treated with 10% methanol and 3% hydrogen peroxide in PBS for 5 min. The
slides were then incubated with 3% normal rabbit serum and with 3 µg/mL of
a goat anti-rat ERß polyclonal antibody that recognizes the amino
terminus domain of the rat protein (sc-6821; Santa Cruz Biotechnology, Santa
Cruz, CA), at 4°C, for 16 hours. After PBS washing, sections were exposed
to biotinylated rabbit anti-goat IgG as a secondary antibody for 30 minutes
(Vector Laboratories) and treated with avidin-biotin complex (Vectastain ABC
Kit; Vector Laboratories) for 45 minutes. Bound peroxidase was visualized
using 0.01% hydrogen peroxide and 0.05% diaminobenzidine in PBS.
Preparation of Cytoplasmic and Nuclear Extracts![]()
Cytoplasm and nuclear extracts of total testis were prepared as follows:
decapsulated testes were immersed in buffer A (10 mmol/L Tris-HCL [pH 7.4], 2
mmol/L EDTA, and 0.25 mol/L sucrose) that contained the protease inhibitors
phenylmethylsulfonyl fluoride (0.2 mmol/L), aprotinin (5 mg/mL), and leupeptin
(5 mg/mL). Testes were homogenized in a motorized homogenizer and then
centrifuged at 800 x g for 10 minutes. The supernatant was
centrifuged at 10 000 x g for 30 minutes, to obtain the
cytosolic fraction. The nuclear pellet was washed and resuspended in RIPA
buffer (50 mmol/L Tris-Cl [pH 7.5] and 150 mmol/L NaCl, 1% Nonidet P-40, 0.5%
sodium deoxycholate, and 0.1% SDS) that contained the protease inhibitors
described above, then lysed in the homogenizer and centrifuged at 10 000
x g for 30 minutes. The supernatant was kept as the nuclear
fraction.
Protein Extraction and Western Blot Analysis![]()
Fractions of total testis were lysed with RIPA buffer that contained
protease inhibitors (as described above), and the lysates were centrifuged at
13 000 x g at 4°C for 30 minutes. The protein content of
the supernatant was determined by the Bradford assay (Bio-Rad Laboratories).
Equals amounts of protein (30 µg) were resolved by 10% SDS-polyacrylamide
gel electrophoresis and transferred to nitrocellulose membranes. After
blocking, the membranes were incubated at 4°C overnight with 2 µg/mL of
2 rabbit polyclonal antibodies raised against the amino-terminal region of
mouse ERß (sc-6821; Santa Cruz Biotechnology, and PA1-311; Affinity
Bioreagents Inc., Golden, CO) and then for 1 hour at room temperature with
horseradish peroxidase-conjugated secondary antibody (1: 2000). Peroxidase
activity was analyzed with the ECL system (Amersham Pharmacia Biotech),
according to the manufacturer's instructions. The ERß content was
determined densitometrically. To confirm that similar amounts of protein were
loaded onto each lane, membranes were stained with Coomassie brilliant blue
R-250.
LCM![]()
Stage-specific seminiferous tubules were harvested from frozen, testicular
sections of control and MAA-administered rats by LCM, as described elsewhere
(Suárez-Quian et al,
2000; Tirado et al,
2003). Specifically, 5-µm frozen sections were cut on a
standard cryostat with a fresh blade, and 2 sections each were mounted on
Colorfrost Plus glass slides (Fisher Scientific, Pittsburgh, PA). The unfixed
sections were immediately stored at -80°C. The frozen sections were thawed
at room temperature for 30-60 seconds without drying and immersed in 70%
ethanol to fix for 30 seconds. After fixation, slides were stained with
hematoxylin (1 minutes) and eosin (15 seconds), dehydrated in ascending grades
of ethanol (70%, 90%, and 100%), twice in each for 1 minute, and immersed in
Xylene, twice, for 5 minutes each. The seminiferous tubules were staged using
the scheme of Leblond and Clermont
(1952) and microdissected
using a Pixell II apparatus (Arcturus, Mountain View, CA). An infrared laser
pulse of 90 mW and beam size of 30 µm were pulsed over the tubules of
interest, the ethylene vinyl acetate thermoplastic film was melted directly
onto these tubules, and the captured tissue was transferred to a thermoplastic
polymer film-coated cap by the 1-step transfer method. The transfer film cap
was placed directly into a microcentrifuge tube for RNA extraction.
Total RNA Extraction from Captured Seminiferous Tubules![]()
Total RNA was obtained from microdissected tubules by using the Micro RNA
isolation Kit (Stratagene, La Jolla, CA), according to the manufacturer's
instructions.
Cell Culture and Transient Transfection Assay![]()
Human hepatoma (HepG2) cells were maintained at 37°C, 5% CO2
in MEM (Invitrogen Corp., Carlsbad, CA) containing phenol red and supplemented
with 10% FBS (Hyclone Laboratories Inc., Logan, UT), 1 mmol/L sodium pyruvate,
and 100 nmol/L nonessential amino acids (Invitrogen). Cells were seeded into
24-well plates at 60% confluence 24 hours before transfection. Cells were
washed once with 1x PBS and transfected with a lipofectin
(Invitrogen)-DNA mixture that contained 3 µg total DNA per triplicate.
Transfection mixtures contained 2000 ng 3x ERE TATA Luc, 100 ng CMV
ß-galactosidase, 500 ng pRST7 hERß, and 400 ng pBS-KSII+
(Stratagene). After a 5-hour transfection, medium was replaced with phenol
red-free MEM supplemented with 10% dextran-stripped FBS (Hyclone
Laboratories), 1 mmol/L sodium pyruvate, and 100 nmol/L nonessential amino
acids. The cells were incubated for 16 hours before 17ß-estradiol or
increasing concentrations of MAA were added to the transfected cells and
treated for 24 hours. A 20-mmol/L stock MAA solution was prepared by adding
98% pure MAA to the medium and adjusting the pH to 7.4 with 10 N
NaOH. Subsequently, the cells were lysed and assayed for luciferase and
ß-galactosidase activities. Luciferase activity was divided by
ß-galactosidase activity, to normalize for transfection efficiency. Data
are presented as the average of triplicate transfections, and the assay was
repeated 3 times.
Statistical Analysis![]()
For experiments shown in Figures
2,
4,
5, and
6 below, at least 3
replications were used for each group within an experiment. Analysis of
variance was used to assess statistical significance between group means, and
groups were considered to be statistical different at P
.05.
|
|
|
|
| Results |
|---|
|
|
|---|
To further characterize the experimental model, TUNEL assays were done in the testis of the MAA-treated animals as well in controls. In control testes, isolated TUNEL-labeled cells were detected in some seminiferous tubules, but, in general, there was a lack of positive staining in most tubule profiles (Figure 1A). At 3 and 6 hours after MAA administration, there were no significant differences in the number of TUNEL-labeled cells, compared with control testes, but a gradual increase was noted at 9-12 hours that remained high at 24 hours. The majority of labeled cells were identified as pachytene spermatocytes (Figure 1B). Three days after the administration of MAA, primary spermatocytes were absent in most tubule stages and only a few, isolated labeled cells, identified as degenerating spermatogonia, could be discerned. Similar images were obtained in testis analyzed at 5 and 7 days after the toxicant (data not shown).
|
Examination of TUNEL labeling at low magnification revealed a stage-specific distribution of the reaction product in pachytene spermatocytes beginning 6 hours after the compound's administration (Table 1). Although positive TUNEL staining was present in the majority of stages, maximal staining was observed in latter stages of the cycle of the seminiferous epithelium, specifically at stages X-XIII.
|
ERß mRNA Expression after MAA Administration![]()
The levels of ERß mRNA were examined by semiquantitative RT-PCR in
both unseparated testicular cells (a total testis cell fraction) and in
isolated gem cells. In the unseparated testicular cells, a significant
increase in ERß mRNA expression became noticeable at 6 hours after MAA
administration and remained altered after 9 hours. In the isolated germ cells,
although a progressive increase was noted starting at 3 hours
(Figure 2), a significant
increase in the ERß mRNA levels was not discerned until 9 hours after MAA
exposure. The sequence analysis of the products confirmed the identity of the
amplified cDNA bands with the sequences used to design the primer probes.
ERß Immunodetection in Pachytene Spermatocytes after MAA
Administration![]()
In previous immunohistochemical studies, ERß was shown to reside in
the nuclei of Sertoli cells and pachytene spermatocytes, although no
differential stage-specific intensity immunostaining was observed
(Saunders et al, 1998). Using
an antibody against the amino-terminal region of ERß, we also examined
its distribution in control and in MAA-treated rats
(Figure 3). In control animals,
ERß immunoreactivity was present in the nuclei of Sertoli cells and
pachytene spermatocytes and in the cytoplasm of pachytene spermatocytes and
elongated spermatids, although this latter labeling appeared as a faint but
widespread immunostaining (Figure
3A). In some tubules, however, robust ERß immunostaining
could be observed in isolated pachytene spermatocytes appearing to be in a
state of cell degeneration. These degenerating cells were characterized by
chromatin clumping and a lack of cytoplasmic density. Beginning at 9 hours and
remaining up to 24 hours after MAA administration, an intense ERß
immunostaining was noted in the cytoplasm of a significant number of pachytene
spermatocytes residing in stages X-XIII of the cycle of the seminiferous
epithelium (Figure 3B-E),
corresponding to the stages with increased number of TUNEL-labeled cells
(Figure 3F and 3G). In stages
II-III, a lower (but readily detectable) number of cells were also positive
for ERß (Figure 3C) and
TUNEL (Figure 3F). In stages
VII-VIII, a faint ERß immunostaining was observed only in a few pachytene
spermatocyte cells (Figure 3D),
but no TUNEL labeling was ever detected in the pachytene spermatocytes
inhabiting these stages (Figure
3G). Furthermore, careful inspection of the ERß
immunohistochemistry of labeled pachytene spermatocytes revealed a
significant, punctuate immunostaining within the nuclei of the cells. However,
because of the high intensity of the cytoplasmic reaction in pachytene
spermatocytes of MAA-treated rats, the reaction was stopped earlier in these
sections than in controls, and the nuclear immunostaining was often masked and
easily missed unless a thorough focus of the pachytene spermatocyte nucleus
was done.
|
Up-regulation of ERß Protein after MAA Exposure Measured by
Western Blot Analysis![]()
To verify the results obtained by inmunohistochemistry, Western blot
analysis was done in cytosolic and nuclear testicular extracts, using 2
different antibodies raised against peptidic sequences of the N-terminal
region of rat ERß. Both antibodies recognized a single 55-kDa protein
species, and the specificity of the reaction was demonstrated by the
disappearance of the band when one of the antibodies (Santa Cruz
Biotechnology) was incubated with the corresponding peptide
(Figure 4). Expression of the
ERß protein was detected in the cytoplasmic and nuclear fractions, but
the most significant increase was noted in the cytoplasmic fraction during the
time course of the experiment (Figure
4), in agreement with the results obtained by
immunohistochemistry.
Capture of Seminiferous Tubules in a Stage-Specific Manner and mRNA
Expression of ERß![]()
LCM was done successfully using frozen testicular sections fixed with 70%
ethanol, obtained from 3 control rats and 3 rats killed 12 h after the MAA
administration. The different stages of the seminiferous epithelium were
optically identified in H&E-stained sections at 630x magnification
(Figure 5A). A total of 50
seminiferous tubules, at stages III-IV, VII-VIII, or X-XIII, respectively,
were selected for microdissection. The stage-specific tubular sections were
captured without interstitial contamination
(Figure 5B). The mRNA
expression of ERß and L19 as a control was analyzed in the RNA extracted
from these tubules by RT-PCR using the specific primers already described. A
clear up-regulation of ERß mRNA was observed in all tubules obtained from
injected animals, compared with controls
(Figure 5C).
MAA Effects on ERß![]()
Direct effects of MAA on ERß activation were examined using HepG2
cells stably cotransfected with a specific ERß-responsive element and a
luciferase reporter system. Results indicated that MAA at 5 mmol/L had an
identical ability to activate the ERß as estradiol at 1 nmol/L
concentration (Figure 6).
| Discussion |
|---|
|
|
|---|
All results of the present investigation point to the fact that the short-term exposure of rats to MAA leads to the rapid increase in ERß protein and mRNA levels in pachytene spermatocytes destined to undergo apoptosis. The authenticity of the immunostaining results was confirmed using Western blot analysis of cytosolic and nuclear testicular extracts, using 2 distinct commercial antibodies, and, again, testicular cells treated with MAA rendered a more robust signal for cytoplasmic ERß than control cells. Taken together, these results are consistent with the interpretation that MAA action resulting in pachytene spermatocyte apoptosis entails the disruption of the normal expression levels and disposition of ERß in these cells.
These observations led us to pose 3 questions. First, does MAA directly
and/or indirectly affect ERß levels, or are the effects mediated via
other cells of the seminiferous tubules, possibly the Sertoli cell? Second,
does MAA exhibit ERß activity? Third, does aberrant ERß exert a
direct role in pachytene spermatocyte apoptosis? Regarding question 1, aside
from data presented in the present article, there is no evidence either way to
definitively settle this question in germ cells. Unfortunately, isolated
pachytene spermatocytes do not withstand prolonged cultured conditions to
rigorously test this hypothesis. Nevertheless, given our in vivo findings that
both ERß mRNA and protein are elevated in afflicted pachytene
spermatocytes, a reasonable conclusion is that MAA alters ERß levels in
these cells. Whether it does so directly or via Sertoli cells, however,
remains to be determined. Regarding question 2, we demonstrated that the
addition of MAA at similar doses used in vivo (5 mmol/L) to HepG2 cells
cotransfected with ERß and a luciferase reporter construct containing a
consensus estrogen responsive element elicited a similar estrogenic activation
as estradiol at 1 nmol/L concentration. Thus, these results confirm that MAA
exhibits ERß activity, at least in a model system engineered to
demonstrate this activity. Regarding question 3, ongoing experiments and
evidence from the literature favor the interpretation that elevated levels of
ERß are associated with germ cell apoptosis, especially given that we
demonstrated here when it is located in the cytoplasm. First, in the present
experiments, we observed repeatedly that significant ERß immunostaining
was found in scattered, isolated germ cells undergoing degeneration in control
testis, which possibly suggests that ERß has an active role in this step
during normal spermatogenesis. Conversely, we showed that, in primary
spermatocytes of seminiferous tubular stage VII, the stage where the germ
cells are least at risk of degeneration in normal rats, TUNEL staining was
absent and ERß was nearly impossible to detect in the MAA-treated rats
(Kerr, 1992). Although
ERß mRNA expression was found in stages VII-VIII of MAA-treated animals
by microdissection, it is possible to speculate that this mRNA will be
translated into protein at advanced stages and that the protein will
accumulate in the stages found by immunohistochemistry. In addition, some of
the ERß mRNA is certainly attributable to Sertoli cells, because no
attempt was made to isolate by LCM germ cells that were free of Sertoli cells.
An alternative explanation for the lack of correlation between the levels of
mRNA and protein, however, may be the fact that the ERß protein could be
more strictly regulated than the mRNA. In this regard, it has been shown that
both ER
and ß (Alarid et al,
1999; Tschugguel et al,
2003) can be rapidly regulated via a proteasome-mediated
pathway.
A second piece of evidence that associates ERß and apoptosis is the detection of a robust ERß immunoreactivity in degenerating pachytene spermatocytes in another model of primary spermatocyte apoptosis (unpubl. data), the androgen-binding protein transgenic mouse (Selva et al, 2000). Given this apparent association of enhanced ERß mRNA and protein with apoptotic pachytene spermatocytes, ongoing experiments using aromatase inhibitors will test directly whether the inhibition of P450 activity will produce a protective effect on MAA-induced apoptosis of pachytene spermatocytes. If our prediction holds true that aberrant ERß expression is intimately involved in pachytene spermatocyte apoptosis, then the inhibition of estrogenic activity, regardless of ERß levels after MAA treatment, should dramatically diminish pachytene spermatocyte apoptosis. In addition, other experiments will use antiestrogenic compounds to try and dissect out whether ERß involvement in apoptosis works via genomic effects or whether the cytoplasmic disposition of the receptor is indicating a nongenomic action heretofore unknown in the apoptotic process.
The enhanced cytoplasmic expression of ERß observed by immunohistochemistry and Western blot analysis, and our suggestion that it may be directly implicated in the apoptotic process, may appear to be in conflict with the ability of MAA to potentiate the genomic effects of estrogen detected in the transfection/promoter model system. As demonstrated in "Results," however, it is important to note that, even in the presence of enhanced cytoplasmic ERß expression, nuclear disposition of the receptor was present. Thus, it is possible that MAA does exert a genomic effect and that the enhanced cytoplasmic presence of the ERß is merely an inability of nuclear targeting of a steroid receptor in dying cells. Alternatively, as has been suggested for other nongenomic actions of steroid receptors (Beato and Klug, 2000; Moggs and Orphanides, 2001), perhaps it is now necessary to speculate that the enhanced expression of the ERß in the cytoplasm is associated with apoptosis.
Moreover, the functional studies demonstrating elevated levels of ERß
with pachytene spermatocyte apoptosis described above are consistent with
emerging concepts in the literature that link elevated ERß levels to
cellular apoptosis. For example, estradiol was shown to function either as a
neuroprotective agent or as an inducer of apoptosis in cultured neurons,
depending on the estrogen receptor subtype present in the cell; ER
was
a neuroprotective factor, but ERß acted as a mediator of apoptosis
(Nilsen et al, 2000). Similar
to our findings, ERß immunoreactivity was increased in the cytoplasm of
degenerative hippocampal neurons in patients with Alzheimer disease
(Savaskan et al, 2001) and in
colonocytes of a cell line that lacked ER
expression (COLO205) and
degenerated by apoptosis when the cells were treated with estradiol
(Qiu et al, 2002). Conversely,
ERß expression was diminished in conditions where cell survival was
favoredbreast, colon, ovarian, and prostate cancers
(Leygue et al, 1998;
Pujol et al, 1998; Foley et al, 2000;
Iwao et al, 2000;
Rutherford et al, 2000; Campbell-Thompson et al, 2001;
Horvath et al, 2001; Pasquali et al, 2001;
Roger et al, 2001) and
ERßKO mice at 1 year of age develop lesions in their prostates similar to
intraepithelial neoplasia (Weihua et al,
2002). All of these data support the hypothesis that ERß can
act as a negative regulator of proliferation. In addition, because the
immunohistochemical localization of the ERß seems to be different as a
function of the specific domain recognized by each ERß antibody
(Rosenfeld et al, 1998) and
several forms of ERß have been described in testis
(Makinen et al, 2001), it is
possible that the induction of apoptosis depends on the specific ERß
variant present in the cell.
In summary, although the normal expression of ERß in pachytene spermatocytes implicates its function in normal spermatogenic progression, clearly, whether the elevation of ERß message and protein levels under certain conditions is an epiphenomenon of apoptosis or a causative mediator merits further investigation. At the present time, the accumulating body of evidence seems to favor the interpretation that ERß is a direct participant in this process. Because, in general, endocrine disruptors have a high affinity for ERß, this action may help explain the fertility problems caused by a large number of chemical compounds exhibiting estrogenic activity.
| Footnotes |
|---|
The authors thank Maria Pons (Anatomia Patològica, Hospital Vall d'Hebron, Barcelona) for her excellent technical assistance.
| References |
|---|
|
|
|---|
Allan DJ, Harmon BV, Roberts SA. Spermatogonial apoptosis has three morphological recognizable phases and shows no circadian rhythm during normal spermatogenesis in the rat. Cell Prolif. 1992; 25:241-250.[Medline]
Bartlett JMS, Kerr JB, Sharpe RM. The selective removal of
pachytene spermatocytes using methoxy acetic acid as an approach to the study
in vivo of paracrine interactions in the testis. J
Androl. 1988;9:31-40.
Beato M, Klug J. Steroid hormone receptors: an update.
Hum Reprod Update. 2000; 6:225-236.
Blanco-Rodriguez J, Martínez-García C. Induction of apoptotic cell death in the seminiferous tubule of the adult rat testis: assessment of the germ cell types that exhibit the ability to enter apoptosis after hormone suppression by oestradiol treatment. Int J Androl. 1996;19:237-247.[Medline]
Brinkworth MH, Weinbauer GH, Schlatt S, Nieschlag E. Identification of male germ cells undergoing apoptosis in adult rats. J Reprod Fertil. 1995;105:25-33.
Campbell-Thompson M, Lynch IJ, Bhardwaj B. Expression of estrogen
receptor (ER) subtypes and ERbeta isoforms in colon cancer. Cancer
Res. 2001;61:632-640.
Carreau S, Bourguiba S, Lambard S, Galeraud-Denis I, Genissel C, Levallet J. Reproductive system: aromatase and estrogens. Mol Cell Endocrinol. 2002;193:137-143.[Medline]
Carreau S, Levallet J. Cytochrome P450 aromatase in male germ cells. Folia Histochem Cytobiol. 1997; 35:195-202.[Medline]
Chomzinsky P, Sacchi N. Single step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline]
Clark AM, Maguire SM, Griswold MD Accumulation of clusterin/sulfated glycoprotein-2 in degenerating pachytene spermatocytes of adult rats treated with methoxyacetic acid. Biol Reprod. 1997;57:837-846.[Abstract]
Ebling FJ, Brooks AN, Cronin AS, Ford H, Kerr JB. Estrogenic
induction of spermatogenesis in the hypogonadal mouse.
Endocrinology. 2000; 141:2861-2869.
Foley EF, Jazaeri AA, Shupnik MA, Jazaeri O, Rice LW. Selective
loss of estrogen receptor beta in malignant human colon. Cancer
Res. 2000;60:245-248.
Foster PMD, Lloyd SC, Blackburn DM. Comparison of the in vivo and in vitro testicular effects produced by methoxy-, ethoxy- and N-butoxyacetic acids in the rat. Toxicology. 1987; 43:17-30.[Medline]
Henriksen K, Hakovirta H, Parvinen M. Testosterone inhibits and induces apoptosis in rat seminiferous tubules in a stage-specific manner: in situ quantification in squash preparations after administration of ethane dimethane sulfonate. Endocrinology. 1995; 136:3285-3291.[Abstract]
Horvath LG, Henshall SM, Lee CS, et al. Frequent loss of estrogen
receptor-beta expression in prostate cancer. Cancer
Res. 2001;61:5331-5335.
Iwao K, Miyoshi Y, Egawa C, Ikeda N, Noguchi S. Quantitative analysis of estrogen receptor-beta mRNA and its variants in human breast cancers. Int J Cancer. 2000; 88:733-736.[Medline]
Janulis L, Bahr JM, Hess RA, Janssen S, Osawa Y, Bunick D. Rat
testicular germ cells and epididymal sperm contain active P450 aromatase.
J Androl. 1998;19:65-71.
Kerr JB. Spontaneous degeneration of germ cells in normal rat testis: assessment of cell types and frequency during the spermatogenic cycle. J Reprod Fertil. 1992; 95:825-830.
Krishnamurthy H, Weinbauer GF, Aslam H, Yeung CH, Nieschlag E.
Quantification of apoptotic testicular germ cells in normal and methoxyacetic
acid-treated mice as determined by flow cytometry. J
Androl. 1998;19:710-717.
Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA.
Cloning of a novel receptor expressed in rat prostate and ovary.
Proc Natl Acad Sci USA. 1996; 93:5925-5930.
Leblond CP, Clermont Y. Definition of the stages of the cycle of the seminiferous epithelium in the rat. Ann N Y Acad Sci. 1952;55:548-573.
Levallet J, Bilinska B, Mittre H, Genissel C, Fresnel J, Carreau S.
Expression and immunolocalization of functional cytochrome P450 aromatase in
mature rat testicular cells. Biol Reprod. 1998; 58:919-926.
Leygue E, Dotzlaw H, Watson PH, Murphy LC. Altered estrogen
receptor alpha and beta messenger RNA expression during human breast
tumorigenesis. Cancer Res. 1998; 58:3197-3201.
Macaya A, Munell F, Gubits RM, Burke RE. Apoptosis in substantia
nigra following developmental striatal excitotoxic injury. Proc
Natl Acad Sci USA. 1994;91:8117-8121.
Makinen S, Makela S, Weihua Z, Warner M, Rosenlund B, Salmi S,
Hovatta O, Gustafsson JK. Localization of oestrogen receptors alpha and beta
in human testis. Mol Hum Reprod. 2001; 7:497-503.
Moggs JG, Orphanides G. Estrogen receptors: orchestrators of pleiotropic cellular responses. EMBO Rep. 2001; 9:775-781.
Nilsen J, Mor G, Naftolin F. Estrogen-regulated developmental neuronal apoptosis is determined by estrogen receptor subtype and the Fas/Fas ligand system. J Neurobiol. 2000; 43:64-78.[Medline]
Nitta H, Bunick D, Hess RA, et al. Germ cells of the mouse testis express P450 aromatase. Endocrinology. 1993; 132:1396-1401.[Abstract]
O'Donnell L, Robertson KM, Jones ME, Simpson ER. Estrogen and
spermatogenesis. Endocr Rev. 2001; 22:289-318.
Park TR, Lynch GR, Tsai PS. Estrogen accelerates gonadal recrudescence in photo-regressed male Siberian hamsters. Endocrinol. 2002; 143:4131-4134.[Abstract]
Pasquali D, Rossi V, Esposito D, Abbondanza C, Puca GA, Bellastella
A, Sinisi AA. Loss of estrogen receptor beta expression in malignant human
prostate cells in primary cultures and in prostate cancer tissues J
Clin Endocrinol Metab. 2001; 86:2051-2055.
Pentikainen V, Erkkila K, Suomalainen L, Parvinen M, Dunkel L.
Estradiol acts as a germ cell survival factor in the human testis in vitro.
J Clin Endocrinol Metab. 2000; 85:2057-2067.
Pujol P, Rey JM, Nirde P, Roger P, Gastaldi M, Laffargue F,
Rochefort H, Maudelonde T. Differential expression of estrogen receptor-alpha
and -beta messenger RNAs as a potential marker of ovarian carcinogenesis.
Cancer Res. 1998; 58:5367-5373.
Qiu Y, Waters CE, Lewis AE, Langman MJ, Eggo MC. Oestrogen-induced apoptosis in colonocytes expressing oestrogen receptor beta. J Endocrinol. 2002;174:369-377.[Abstract]
Reventos J, Munell F. Transgenic animal models in reproductive
endocrine research. Eur J Endocrinol. 1997; 136:566-580.
Robertson KM, O'Donnell L, Jones ME, et al. Impairment of
spermatogenesis in mice lacking a functional aromatase (cyp 19) gene.
Proc Natl Acad Sci USA. 1999; 96:7986-7991.
Roger P, Sahla ME, Makela S, Gustafsson JA, Baldet P, Rochefort H.
Decreased expression of estrogen receptor beta protein in proliferative
preinvasive mammary tumors. Cancer Res. 2001; 61:2537-2541.
Rosenfeld CS, Ganjam VK, Taylor JA, Yuan X, Stiehr JR, Hardy MP,
Lubahn DB. Transcription and translation of estrogen receptor-beta in the male
reproductive tract of estrogen receptor-alpha knock-out and wild-type mice.
Endocrinology. 1998; 139:2982-2987.
Rutherford T, Brown WD, Sapi E, Aschkenazi S, Munoz A, Mor G.
Absence of estrogen receptor-beta expression in metastatic ovarian cancer.
Obstet Gynecol. 2000; 96:417-421.
Sassone-Corsi P. Transcriptional checkpoints determining the fate of male germ cells. Cell. 1997; 88:163-166.[Medline]
Saunders PTK, Fisher JS, Sharpe RM, Millar MR. Expression of oestrogen receptor beta (ERß) occurs in multiple cell types, including some germ cells, in the rat testis. J Endocrinol. 1998; 156:R13-R17.[Abstract]
Savaskan E, Olivieri G, Meier F, Ravid R, Muller-Spahn F. Hippocampal estrogen beta-receptor immunoreactivity is increased in Alzheimer's disease. Brain Res. 2001; 908:113-119.[Medline]
Selva DM, Hogeveen KN, Seguchi K, Tekpetey F, Hammond GL. A human
sex hormone-binding globulin isoform accumulates in the acrosome during
spermatogenesis. J Biol Chem. 2002; 277:45291-45298.
Selva DM, Tirado OM, Toran N, Suárez-Quian CA, Reventos J,
Munell F. Meiotic arrest and germ cell apoptosis in androgen-binding protein
transgenic mice. Endocrinology. 2000; 141:1168-1177.
Suárez-Quian CA, Goldstein SR, Bonner RF. Laser capture microdissection: a new tool for the study of spermatogenesis. J Androl. 2000;21:601-608.[Medline]
Suárez-Quian CA, Martinez-Garcia F, Nistal M, Regadera J.
Androgen receptor distribution in adult human testis. J Clin
Endocrinol Metab. 1999;84:350-358.
Tirado OM, Martinez ED, Rodriguez OC, Danielsen M, Selva DM,
Reventos J, Munell F, Suárez-Quian CA. Methoxyacetic acid disregulation
of androgen receptor and androgen-binding protein expression in adult rat
testis. Biol Reprod. 2003; 68:1437-1446.
Tschugguel W, Dietrich W, Zhegu Z, Stonek F, Kolbus A, Huber JC.
Differential regulation of proteasome-dependent estrogen receptor alpha and
beta turnover in cultured human uterine artery endothelial cells. J
Clin Endocrinol Metab. 2003; 88:2281-2287.
Van Pelt AM, de Rooij DG, van der Burg B, van der Saag PT,
Gustafsson JA, Kuiper GG. Ontogeny of estrogen receptor-beta expression in rat
testis. Endocrinology. 1999; 140:478-483.
Weihua Z, Warner M, Gustafsson J. Estrogen receptor beta in the prostate. Mol Cell Endocrinol. 2002; 193:1-5.[Medline]
Weiss M, Vigier M, Hue D, Perrard Sapori MH, Marret C, Avallet O, Durand P. Pre- and postmeiotic expression of male germ cell specific genes throughout 2 week co-cultures of germinal and Sertoli cells. Biol Reprod. 1997;57:68-76.[Abstract]
Woolveridge I, de Boer-Brouwer M, Taylor MF, Teerds KJ, Wu FC,
Morris ID. Apoptosis in the rat spermatogenic epithelium following androgen
withdrawal: changes in apoptosis-related genes. Biol
Reprod. 1999;60:461-470.
Zirkin BR, Santulli R, Awoniyi CA, Ewing LL. Maintenance of advanced spermatogenic cells in the adult rat testis: quantitative relationship to testosterone concentration within the testis. Endocrinology. 1989; 124:3043-3049.[Abstract]
This article has been cited by other articles:
![]() |
M. G. Wade, A. Kawata, A. Williams, and C. Yauk Methoxyacetic Acid-Induced Spermatocyte Death Is Associated with Histone Hyperacetylation in Rats Biol Reprod, May 1, 2008; 78(5): 822 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Tabb and B. Blumberg New Modes of Action for Endocrine-Disrupting Chemicals Mol. Endocrinol., March 1, 2006; 20(3): 475 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Wade, R. Poon, N. Li, A. Lee, A. McMahon, and I. Chu Testicular Toxicity of Candidate Fuel Additive 1,6-Dimethoxyhexane: Comparison with Several Similar Aliphatic Ethers Toxicol. Sci., January 1, 2006; 89(1): 304 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Selva, O. M. Tirado, N. Toran, C. A. Suarez-Quian, J. Reventos, and F. Munell Estrogen Receptor {beta} Expression and Apoptosis of Spermatocytes of Mice Overexpressing a Rat Androgen-Binding Protein Transgene Biol Reprod, November 1, 2004; 71(5): 1461 - 1468. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A Oliveira, G. A B Mahecha, K. Carnes, G. S Prins, P. T K Saunders, L. R Franca, and R. A Hess Differential hormonal regulation of estrogen receptors ER{alpha} and ER{beta} and androgen receptor expression in rat efferent ductules Reproduction, July 1, 2004; 128(1): 73 - 86. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |